NEET Zoology Molecular Basis Of Inheritance Class 12 Questions

Select the incorrect pair w.r.t. Lac operon.

Consider the following statements: (a) Methyl guanosine triphosphate is added to 5' end of hnRNA. (b) A segment of DNA coding for polypeptide is Intron. (c) rRNA provides template for synthesis of proteins. (d) RNA polymerase I transcribes rRNA (e) Rho factor binds to RNA polymerase to terminate transcription.

In the lac operon system, permease is coded by

In transcription in eukaryotes, rRNA is transcribed by?

Which of the following statements is correct regarding eukaryotic translation?

The correct statement with regard to the secondary structure of DNA/RNA is

Arrange the following steps of DNA fingerprinting in a correct sequence.

Which of the following statements are correct with reference to packaging of DNA helix?

Which of the following statements are correct with respect to DNA separation, isolation and visualization?

Histones are enriched with -

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

Which factor is important for termination of transcription?

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3’ TACATGGCAAATATCCATTCA 5’

Match List I with List II:

Match List I with List II.

Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3’?

In an E.coli strain γ gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome?

If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?

Ten E.coli cells with ¹⁵N⁻dsDNA are incubated in medium containing ¹⁴N nucleotide. After 60 minutes how many E.coli cells with have DNA totally free from ¹⁵N?

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

Under which of the following conditions will there be no change in the reading frame of following mRNA? 5’AAACAGCGGUGCUAAU 3’

Match the following elements of the lac operon with their respective products:

Expressed Sequence Tags (ESTs) refers to:

Select the correct match.

DNA fragments are

If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered?

Which one of the following is the starter codon?

Which of the following is required as inducer(s) for the expression of Lac operon?

Which one of the following is wrongly matched?

In an inducible operon, the genes are:

Which of the following is not a property of the genetic code?

DNA → iii → mRNA → ii → Protein Proposed by i The figure gives an important concept in the genetic implication of DNA. Fill the blanks A, B and C.