NEET Botany Molecular Basis Of Inheritance Class 12 Questions

The backbone in a polynucleotide chain is formed due to

In RNA, every nucleotide residue has an additional -OH group at which of the following position

Which one statement regarding "Okazaki fragment" is correct:

With regard to mature mRNA in eukaryotes:

In Hershey – Chase experiment, the virus which had radioactive DNA had

Genetic code consists of

The core of nucleosome is made up of two units each of

Which enzyme caused no transformation in Avery, MacLeod and McCarty's experiment?

Which one of the following pairs of nitrogenous bases of nucleic acids, is WRONGLY matched with the category mentioned against it?

The following ratio is always unity, according to chargaff rule?

Find out the incorrect statement from the following.

Which of the following is NOT a part of a transcription unit in DNA?

Assertion (A): The transcription and translation can be coupled in bacteria. Reason (R): In bacteria, the mRNA does not require any processing to become active, and also both transcription and translation take place in cytoplasm.

All of the following are synthesised by RNA polymerase I in eukaryotes, except;

The mRNA sequence generated from the coding strand with the sequence given below will be; 5’ ATGTGTGACTGATGAC 3’

The experimental proof for semi-conservative replication of DNA in chromosomes by Taylor et. al. was shown in

Statement - I: The DNA polymerases on their own can not initiate the process of replication. Statement-II: In addition on to DNA dependent DNA polymerases, many additional enzymes are required to complete the process of replication with high degree of accuracy.

What is another chemical name for thymine

The nucleosomes constitute the repeating unit of a structure in nucleus called

Given below are two statements Statement I: The bacteriophage attaches to the bacteria and its protein then enters the bacterial cell. Statement II: In Hershey and chase experiment the viruses grown on sulfur contained radioactive protein but not radioactive DNA because DNA does not contain sulfur. Choose the correct answer from the option given below:

Given below are assertion and reason. Mark the correct choice from given options: Assertion: Nucleic acid is the genetic material of all organisms with some exception. Reason: In majority of organisms this is ribonucleic acid or RNA.

Given below are two statements : Statement I : In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. Statement II : DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism. In the light of the above statements, choose the most appropriate answer from the options given below :

Which chromosome in the human genome has the highest number of genes?

Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of exons. C. Addition of methyl group at 5’ end of hnRNA. D. Addition of adenine residues at 3’ end of hnRNA. E. Base pairing of two complementary RNAs. Choose the correct answer from the options given below:

Histones are enriched with -

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

Which factor is important for termination of transcription?

The lactose present in the growth medium of bacteria is transported to the cell by the action of:

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end;

Match List I with List II

Which of the following statement is correct regarding the process of replication in E.coli? (1) The DNA dependent DNA polymerase catalyses polymerization in 5'→3' as well as 3'→5' direction. (2) The DNA dependent DNA polymerase catalyses polymerization in 5'→3' direction. (3) The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3'→5'. (4) The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5'→3'.

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3’ TACATGGCAAATATCCATTCA 5’

Match List I with List II:

Unequivocal proof that DNA is the genetic material was first proposed by

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Expressed Sequence Tags (ESTs) refers to

How many different proteins does the ribosome consist of?

Match List I with List II.

Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’ AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3’?

Read the following statements and choose the set of correct statements: i. Euchromatin is loosely packed chromatin ii. Heterochromatin is transcriptionally active iii. Histone octomer is wrapped by negatively charged DNA in nucleosome iv. Histone are rich in lysine and arginine v. A typical nucleosome contains 400 bp of DNA helix

DNA Polymorphism forms the basis of:

The process of translation of mRNA to proteins begins as soon as:

If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is called as:

In an E.coli strain γ gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome?

If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?

Ten E.coli cells with ¹⁵N⁻dsDNA are incubated in medium containing ¹⁴N nucleotide. After 60 minutes how many E.coli cells with have DNA totally free from ¹⁵N?

Complete the flow chart on central dogma. (a) cDNA (b) _______ mRNA (c) _______ (d)

Identify the correct statement.